Entopsis

OverviewSuggest Edit

Entopsis was founded in 2011 to pursue the simple idea that an unbiased approach to diagnostics using signatures can be clinically and scientifically useful. We are predominantly focused in the ares of oncology, autoimmune disorders, and rare diseases. Entopsis is proud to have established strategic academic and industry collaborations with renowned companies and institutions.
TypePrivate
Founded2011
HQMedley, FL, US
Websiteentopsis.com

Latest Updates

Employees (est.) (Jul 2021)11
Cybersecurity ratingDMore

Key People/Management at Entopsis

Obdulio Piloto

Obdulio Piloto

CEO, Co-Founder
Ian Cheong

Ian Cheong

TGCCACATCGAGTTCCACGCCTGCAAGGAGCGG, Co-Founder
George Huang

George Huang

CFO
Tingjun Lei

Tingjun Lei

Senior Scientist
Peter Chang

Peter Chang

Clinical Advisor, IRB Chairman
Monica Goldberg

Monica Goldberg

Clinical Advisor
Show more

Entopsis Office Locations

Entopsis has an office in Medley
Medley, FL, US (HQ)
7600 NW 69th Ave
Show all (1)

Entopsis Financials and Metrics

Summary Metrics

Founding Date

2011

Entopsis total Funding

$1.4 m

Entopsis latest funding size

$575 k

Time since last funding

6 years ago

Entopsis investors

Entopsis's latest funding round in March 2015 was reported to be $575 k. In total, Entopsis has raised $1.4 m
Show all financial metrics

Entopsis Cybersecurity Score

Cybersecurity ratingPremium dataset

D

66/100

SecurityScorecard logo

Entopsis Online and Social Media Presence

Embed Graph

Entopsis Blogs

Randy Rusz joins Entopsis as their Vice President of Business Development for North America

The Entopsis team is excited to welcome Randy Rusz as Vice President of Business Development for North America. This addition will provide the research and clinical testing communities better access to our R&D team’s innovative solutions aimed at solving key industry problems. Randy brings over …

PCRopsis™ RVD Enhancer makes PCRopsis™ Reagent RVD compatible with most specimen transport mediums

PCRopsis™ Reagent RVD + PCRopsis™ RVD Enhancer offers a direct PCR solution for specimens in most non-inactivating transport mediums. PCRopsis™ Reagent RVD alone has been repeatedly shown to facilitate extraction-free amplification of viral, bacterial, and mammalian specimens in universal viral tran…

PCRopsis™ Reagent RVD mediates direct PCR for less than $1.70 / reaction

PCRopsis™ Reagent RVD was recently shown to mediate direct PCR amplification from viral and bacterial targets using low volumes of reagent and sample, thus drastically lowering costs and increasing testing accessibility. Reagent RVD is a flexible direct PCR product for various research and clinical …

The Entopsis Family Grows with the Launch of the Global Health Institute

Have you ever read about cool, new medical products / tests, only to later realize it won’t be available for years into the future (if ever)? Entopsis is effectively a R&D company that creates novel, impactful technologies for the bio-medical space. They are best known for OpsisDx™ (single platf…

Beyond COVID-19 Testing: Reagent RVD Facilitates Extraction-free Amplification of Bacteria

Reagent RVD has proven capable of amplifying SARS-CoV-2 gene targets directly from universal viral transport (UVT) medium without the need for viral RNA extraction. However, diagnostic reference laboratories also want to use this approach for the amplification of bacterial gene targets. The PCRopsis…

Non-invasive OpsisDx Diagnostic Test Awarded US Academy of Medicine Research Global Award

The U.S. National Academy of Medicine’s Healthy Longevity Global Grand Challenge has awarded a grant to develop Entopsis’ OpsisDx(TM) platform for detecting Parkinson’s disease using skin swabs or urine. This effort is driven by Entopsis’ scientific and clinical collaborators at Singapore’s Temasek …
Show more

Entopsis Frequently Asked Questions

  • When was Entopsis founded?

    Entopsis was founded in 2011.

  • Who are Entopsis key executives?

    Entopsis's key executives are Obdulio Piloto, Ian Cheong and George Huang.

  • How many employees does Entopsis have?

    Entopsis has 11 employees.

  • Who are Entopsis competitors?

    Competitors of Entopsis include MEDIAN Technologies, HealthJoy and CompuGroup Medical.

  • Where is Entopsis headquarters?

    Entopsis headquarters is located at 7600 NW 69th Ave, Medley.

  • Where are Entopsis offices?

    Entopsis has an office in Medley.

  • How many offices does Entopsis have?

    Entopsis has 1 office.