Entopsis

OverviewSuggest Edit

Entopsis was founded in 2011 to pursue the simple idea that an unbiased approach to diagnostics using signatures can be clinically and scientifically useful. We are predominantly focused in the ares of oncology, autoimmune disorders, and rare diseases. Entopsis is proud to have established strategic academic and industry collaborations with renowned companies and institutions.
TypePrivate
Founded2011
HQMedley, US
Websiteentopsis.com

Latest Updates

Employees (est.) (Nov 2020)10
Cybersecurity ratingDMore

Key People/Management at Entopsis

Obdulio Piloto

Obdulio Piloto

CEO, Co-Founder
Ian Cheong

Ian Cheong

TGCCACATCGAGTTCCACGCCTGCAAGGAGCGG, Co-Founder
George Huang

George Huang

CFO
Tingjun Lei

Tingjun Lei

Senior Scientist
Peter Chang

Peter Chang

Clinical Advisor, IRB Chairman
Monica Goldberg

Monica Goldberg

Clinical Advisor
Show more

Entopsis Office Locations

Entopsis has an office in Medley
Medley, US (HQ)
7600 NW 69th Ave
Show all (1)

Entopsis Financials and Metrics

Summary Metrics

Founding Date

2011

Entopsis total Funding

$1.4 m

Entopsis latest funding size

$575 k

Time since last funding

6 years ago

Entopsis investors

Entopsis's latest funding round in March 2015 was reported to be $575 k. In total, Entopsis has raised $1.4 m
Show all financial metrics

Entopsis Cybersecurity Score

Cybersecurity ratingPremium dataset

D

66/100

SecurityScorecard logo

Entopsis Online and Social Media Presence

Embed Graph

Entopsis Blogs

Non-invasive OpsisDx Diagnostic Test Awarded US Academy of Medicine Research Global Award

The U.S. National Academy of Medicine’s Healthy Longevity Global Grand Challenge has awarded a grant to develop Entopsis’ OpsisDx(TM) platform for detecting Parkinson’s disease using skin swabs or urine. This effort is driven by Entopsis’ scientific and clinical collaborators at Singapore’s Temasek …

Entopsis Partners with Madison Core Labs: PCRopsis Reagent RVD

Our team’s passion is to innovate and create powerful, unheard-of solutions to the world’s problems. We pride ourselves on our creativity and desire to make a meaningful difference, both socially and scientifically. However, we can only achieve our global goals with the right partners that share our…

GIA Expands Commercialization of OpsisDx Tests

Genetics Institute of America (GIA) received IRB approval to expand its Prostate Cancer Study (GH215) utilizing OpsisDx to include: Breast, Ovarian and Lung Cancers. OpsisDx will be used to develop accurate, non-invasive tests for the early detection of these 3 additional cancers. GIA, empowered by …

PCRopsis Reagent RVD Launched!

Is viral RNA extraction necessary for amplifying genes from coronaviruses, like SARS-CoV-2? NOT ANY MORE! PCRopsis Reagent RVD allows you to perform direct RT-qPCR from nasopharyngeal / oropharyngeal samples transported in BD Universal Viral Transport media or Copan ESwab. Simple Protocol: Mix sampl…

CDC & FDA Cautions Use of COVID-19 Transport Medias with Guanidine thiocyanate

“The U.S. Food and Drug Administration (FDA) reminds laboratory staff to use transport media (the liquid that maintains a specimen sample while it is transported to a laboratory) that are compatible with the SARS-CoV-2 testing platforms and the processes used in their laboratory to process samples c…

Why OpsisDx? Cardiovascular Disease

‘Why OpsisDx?’ is a blog series written by people part of the Entopsis-verse and offers insights into potential OpsisDxTM addressable medical conditions. In modern times, cardiovascular disease (CVD) has become just as worrisome as epidemics in the early stages of medicine. Currently, CVD accounts f…
Show more

Entopsis Frequently Asked Questions

  • When was Entopsis founded?

    Entopsis was founded in 2011.

  • Who are Entopsis key executives?

    Entopsis's key executives are Obdulio Piloto, Ian Cheong and George Huang.

  • How many employees does Entopsis have?

    Entopsis has 10 employees.

  • Who are Entopsis competitors?

    Competitors of Entopsis include Evidation Health, Doctify and Avalon AI.

  • Where is Entopsis headquarters?

    Entopsis headquarters is located at 7600 NW 69th Ave, Medley.

  • Where are Entopsis offices?

    Entopsis has an office in Medley.

  • How many offices does Entopsis have?

    Entopsis has 1 office.